View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9326_low_22 (Length: 253)
Name: NF9326_low_22
Description: NF9326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9326_low_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 11 - 235
Target Start/End: Original strand, 48172828 - 48173050
Alignment:
| Q |
11 |
tttggtgttttgctgttagtggaatggtggatttggcttattcgttagtgttttcgtttgcaaattgtagtgcaatcgagtgaatattggtgatttgaaa |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48172828 |
tttgttgttttgctgttagtggaatggtggatttggcttattcgttagtgttttcgtttgcaaattgtagtgcaatcgagtgaatattggtgatttgaaa |
48172927 |
T |
|
| Q |
111 |
ctgcagctttatttttgaggtggcattgtgaagtgagtgttgcttgctggtagacttgttgagccttagttttgtattttttactttgtagtagagagtc |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
48172928 |
ctgcagctttatttttgaggtggcattgtgaagtgagtgttgcttgctggtggacttgttgagccttagttttgtattttttactttgtagt--agagtc |
48173025 |
T |
|
| Q |
211 |
tcattgttgtgtgttggtgttttct |
235 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
48173026 |
tcattgttgtgtgttggtgttttct |
48173050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University