View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9326_low_23 (Length: 253)

Name: NF9326_low_23
Description: NF9326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9326_low_23
NF9326_low_23
[»] scaffold0219 (1 HSPs)
scaffold0219 (134-236)||(10610-10712)


Alignment Details
Target: scaffold0219 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: scaffold0219
Description:

Target: scaffold0219; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 134 - 236
Target Start/End: Complemental strand, 10712 - 10610
Alignment:
134 caagattagctaatgcacctacacacatattagcttcatgatatgagtgtcgcacccagtggcggatcttgagtggttttgttggtggtgccataaaact 233  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||    
10712 caagattagctaatgcacctacacacatattagcttcatgatatgagtgtcgcacccagtggcggatcttgggtggttttgttagtggtgccataaaact 10613  T
234 ata 236  Q
    |||    
10612 ata 10610  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University