View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9326_low_29 (Length: 238)

Name: NF9326_low_29
Description: NF9326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9326_low_29
NF9326_low_29
[»] chr2 (1 HSPs)
chr2 (97-176)||(31358385-31358463)


Alignment Details
Target: chr2 (Bit Score: 72; Significance: 7e-33; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 97 - 176
Target Start/End: Complemental strand, 31358463 - 31358385
Alignment:
97 taaatcaacagtgggaaagaaacatgatagttaaaaaagggagagaatgagtacagaaaaataaaattttactcaacatg 176  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
31358463 taaatcaacagtgggaaagaaacatgatagttaaaaa-gggagagaatgagtacagaaaaataaaattttactcaacatg 31358385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University