View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9326_low_34 (Length: 230)
Name: NF9326_low_34
Description: NF9326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9326_low_34 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 7 - 128
Target Start/End: Complemental strand, 36954851 - 36954732
Alignment:
| Q |
7 |
tacttacttcctcagtctcaaattgaatgacctaattatggtcgaaatatgttatgtgaatactccaaaaagttaaactaaactaggagaggagatgata |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
36954851 |
tacttacttcctcagtctcaaattgaatgacctaattatggtcgaaatatgttatgtgaatactccaaaaagttaaactaaactaggagaggagatg--a |
36954754 |
T |
 |
| Q |
107 |
tagtgatgcgtttggctggatg |
128 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
36954753 |
tagtgatgcgtttggctggatg |
36954732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 141 - 224
Target Start/End: Complemental strand, 36954679 - 36954596
Alignment:
| Q |
141 |
ggggattatccttattattgtcatgaaaacatgatgaactggaattgcttgacattaagatccaatccaagtattatgtaattt |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36954679 |
ggggattatccttattattgtcatgaaaacatgatgaactggaattgcttgacattaagatccaatccaagtattatgtaattt |
36954596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University