View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9326_low_34 (Length: 230)

Name: NF9326_low_34
Description: NF9326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9326_low_34
NF9326_low_34
[»] chr2 (2 HSPs)
chr2 (7-128)||(36954732-36954851)
chr2 (141-224)||(36954596-36954679)


Alignment Details
Target: chr2 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 7 - 128
Target Start/End: Complemental strand, 36954851 - 36954732
Alignment:
7 tacttacttcctcagtctcaaattgaatgacctaattatggtcgaaatatgttatgtgaatactccaaaaagttaaactaaactaggagaggagatgata 106  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |    
36954851 tacttacttcctcagtctcaaattgaatgacctaattatggtcgaaatatgttatgtgaatactccaaaaagttaaactaaactaggagaggagatg--a 36954754  T
107 tagtgatgcgtttggctggatg 128  Q
    ||||||||||||||||||||||    
36954753 tagtgatgcgtttggctggatg 36954732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 141 - 224
Target Start/End: Complemental strand, 36954679 - 36954596
Alignment:
141 ggggattatccttattattgtcatgaaaacatgatgaactggaattgcttgacattaagatccaatccaagtattatgtaattt 224  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36954679 ggggattatccttattattgtcatgaaaacatgatgaactggaattgcttgacattaagatccaatccaagtattatgtaattt 36954596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University