View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9326_low_37 (Length: 210)
Name: NF9326_low_37
Description: NF9326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9326_low_37 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 175; Significance: 2e-94; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 18 - 196
Target Start/End: Original strand, 8548427 - 8548605
Alignment:
| Q |
18 |
acatgctcgtgttccatgaaaacacctcaaaaactccttgaaatctcactaacttgaatgttggagtctctttgcaaatacacctcccttatcagcgaag |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
8548427 |
acatgctcgtgttccatgaaaacacctcaaaaactccttgaaatctcactaacttgaatgttggagtctctttgcaaatacacctcccttatcggcgaag |
8548526 |
T |
 |
| Q |
118 |
gattatcttcaattgcacaaaagaagattcagccattgtgaaccactacgagtcactacgaagatcaactagcaccacc |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8548527 |
gattatcttcaattgcacaaaagaagattcagccattgtgaaccactacgagtcactacgaagatcaactagcaccacc |
8548605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 19 - 196
Target Start/End: Original strand, 8545145 - 8545322
Alignment:
| Q |
19 |
catgctcgtgttccatgaaaacacctcaaaaactccttgaaatctcactaacttgaatgttggagtctctttgcaaatacacctcccttatcagcgaagg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
8545145 |
catgctcgtgttccatgaaaacacctcaaaaactccttgaaatctcactaacttgaatgttggagtttctttgcaaatacacctcccttatcagcgaagg |
8545244 |
T |
 |
| Q |
119 |
attatcttcaattgcacaaaagaagattcagccattgtgaaccactacgagtcactacgaagatcaactagcaccacc |
196 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8545245 |
attatcttcaattgcacaaaagaagattcggccattgtgaaccactacgagtcactacgaagatcaactagcaccacc |
8545322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University