View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9327_high_4 (Length: 313)
Name: NF9327_high_4
Description: NF9327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9327_high_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 2 - 302
Target Start/End: Complemental strand, 34077442 - 34077142
Alignment:
| Q |
2 |
caaaaccatgtgatgtgtctctctgatcatacgagggagaagnnnnnnnngtacttttgtgcttcaattaatgtgaaagtggcctatgctttgtattatt |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34077442 |
caaaaccatgtgatgtgtctctctgatcatacgagggagaagaaaaaagagtacttttgtgcttcaattaatgtgaaagtggcctatgctttgtattatt |
34077343 |
T |
 |
| Q |
102 |
cttggttttggcccattcacactttcactttggtttgtgatttgctttgctttgctccatgaatggcaaagctaaagctgtacgtttgtctattccttac |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
34077342 |
cttggttttggcccattcacactttcactttggtttgtgatttgctttgctttgctccatgaatggcaaagctaaagctgtacgtttgtccattccttac |
34077243 |
T |
 |
| Q |
202 |
cgtactaagcatttttggaatctagaaagcatgatgccacccctatctaaggtgttctttatttttatgaccactatcggtttcttagtgaaggtagatt |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
34077242 |
cgtactaagcatttttggaatctagaaagcatgatgccacccctatctaaggtgttctttatttttatgaccactatcggtttcttgatgaaggtagatt |
34077143 |
T |
 |
| Q |
302 |
t |
302 |
Q |
| |
|
| |
|
|
| T |
34077142 |
t |
34077142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 147 - 191
Target Start/End: Original strand, 10483138 - 10483182
Alignment:
| Q |
147 |
tttgctttgctccatgaatggcaaagctaaagctgtacgtttgtc |
191 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
10483138 |
tttgctttgctctatgaatggcaaagctaaagctgtatgtttgtc |
10483182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University