View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9327_high_7 (Length: 259)
Name: NF9327_high_7
Description: NF9327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9327_high_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 1 - 88
Target Start/End: Original strand, 31227247 - 31227334
Alignment:
| Q |
1 |
gattataaagcttaaaggctaagacacaaaagttgaagtgtgctctctctctaaacatgactagttataaggatggtattttactttg |
88 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31227247 |
gattataaagcttaaaggttaagacacaaaagttgaagtgtgctctctctgtaaacatgactagttataaggatggtattttactttg |
31227334 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University