View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9328_high_6 (Length: 206)

Name: NF9328_high_6
Description: NF9328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9328_high_6
NF9328_high_6
[»] chr8 (1 HSPs)
chr8 (65-195)||(3230985-3231112)


Alignment Details
Target: chr8 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 65 - 195
Target Start/End: Original strand, 3230985 - 3231112
Alignment:
65 ataatatgaaatcatattgcataatatatagtgtgacattatttgttgtaaatgcttaatcatgattgtaatatgcagtatgtgatgataatacaaagaa 164  Q
    |||| |||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||     
3230985 ataacatgaaatcatattgcataatgtatagtgtgacattatttgttgcaaatgcttaatcatgattgtaatatgcagtatgtgatgataatacaaaga- 3231083  T
165 gtagttcatgatgttttgatagaacacgaaa 195  Q
      |||||||||||||||||||||||||||||    
3231084 --agttcatgatgttttgatagaacacgaaa 3231112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University