View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9328_low_11 (Length: 321)
Name: NF9328_low_11
Description: NF9328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9328_low_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 17 - 308
Target Start/End: Complemental strand, 12346997 - 12346706
Alignment:
| Q |
17 |
attttggatgttcatggcttgtggactgacagaacaaaaaatgatttattcttttctgtgaatttttgagcctaaccatgtttgcatgtgaggttgagtg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12346997 |
attttggatgttcatggcttgtggactgacagaacaaaaaatgatttattcttttctgtgaatttttgagcctaaccatgtttgcatgtgaggttgagtg |
12346898 |
T |
|
| Q |
117 |
agtgatcaagagagaggaaagaaaagaacaaagaaatgtgtctatgaataagacatgcatgcgatcattttatttatattagtattttccatcgtatatg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
12346897 |
agtgatcaagagagaggaaagaaaagaacaaagaaatgtgtctatgaataagacatgcatgcaatcgttttatttatattagtattttccatcgtatatg |
12346798 |
T |
|
| Q |
217 |
catgacttgcaaaaacatagtacaagatataaatattttaaaaaacatgacaaaagaattcccacttatttggtgagtataagtatgtgtct |
308 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
12346797 |
catgacttgcaaaaacatagtacaaaatataaatattttaaaaaacatgacaaaagaattcccacttgtttggtgaggataagtatgtgtct |
12346706 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University