View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9328_low_23 (Length: 211)
Name: NF9328_low_23
Description: NF9328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9328_low_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 19 - 193
Target Start/End: Original strand, 37223734 - 37223908
Alignment:
| Q |
19 |
aggtgattcaaaatcatattttcactttgtttagcacagatttcccgtaaagctggttgtttcgttgaagtttcatataatctatatgtttcatcccaac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37223734 |
aggtgattcaaaatcatattttcactttgtttagcacagatttcccgtaaagctggttgtttcgttgaagtttcatataatctatatgtttcatcccaac |
37223833 |
T |
 |
| Q |
119 |
atatgctgcaggattactttcattgtccagtagctcggaagctggttcaaccacagtgtccaaggatggcgcaat |
193 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37223834 |
atatgctgcaggattactttcattgtctagtagctcggaagctggttcaaccacagtgtccaaggatggcgcaat |
37223908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University