View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9328_low_8 (Length: 336)
Name: NF9328_low_8
Description: NF9328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9328_low_8 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 17 - 336
Target Start/End: Original strand, 34697614 - 34697926
Alignment:
| Q |
17 |
aagatcatagtgtctcattgtgatatgtcaatctaaacttgtactactttgtgtgtgttttatacaatatgtaccatgacctttaaagtgtacaatatct |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
34697614 |
aagatcatagtgtctcattgtgatatgtcaatctaaacttgtact---ttgtgtgtgttttatacaatatgtaccaagacctctaaagtgtacaatatct |
34697710 |
T |
 |
| Q |
117 |
tatctcaattttattgcaaccaaaccatccccaccgttgtaaattctagcatcattctctaggagcagcatttagtgatatcatttgtaaccttttattt |
216 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34697711 |
tatctcaattt-attgcaacca-----tccccaccgttgtaaattctagcatcattctctaggagcagcatttagtgatatcatttgtaaccttttattt |
34697804 |
T |
 |
| Q |
217 |
atga---caaagattactactcaagtcaaatgaccatgaagtgaaccaccgctaaagtaaccgtatccgtatttgccttgtcaaacatgaaagagtgaaa |
313 |
Q |
| |
|
|||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
34697805 |
atgatgacaaagactactactcaagtcaaatgaccatgaagtgaaccaccgctaaagtaaccgtatccgtatttgccttgtcaaacatgaaagagtg-aa |
34697903 |
T |
 |
| Q |
314 |
gcctactcggtataagatcattt |
336 |
Q |
| |
|
|||||||||| |||||||||||| |
|
|
| T |
34697904 |
gcctactcggcataagatcattt |
34697926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University