View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9330_high_18 (Length: 281)
Name: NF9330_high_18
Description: NF9330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9330_high_18 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 240; Significance: 1e-133; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 1 - 281
Target Start/End: Complemental strand, 33655665 - 33655383
Alignment:
| Q |
1 |
agtgtattgtattgtgaggaagttacataattcagatttgaattactggtgttgcgacgttcagttgggttttggatt--gtggatttggctctgaatgt |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||| |||||||| ||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
33655665 |
agtgtattgtattgtgaggaagttacataattctgatttgaattattggtgttgagacgttcagttgggttttggattttgtggatttggatctgaatgt |
33655566 |
T |
 |
| Q |
99 |
ctgttcaagcaagatccttttaattggaatttagatctgaaagttggaatttggatctatattgatttcaagtttcagctaataaatgtcgaggggaaga |
198 |
Q |
| |
|
||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
33655565 |
ctggtcaagcaagatccttttaattggaatttggatctgaaagttggaatttggatctgtattgatttcaagtttcaactaataaatgtcgaggggaaga |
33655466 |
T |
 |
| Q |
199 |
tctgatgggtcacaaaagaagcgcatagttgcttccatctgtgttgtgacggtttttattggtttattgtatgtgtatggtgg |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33655465 |
tctgatgggtcacaaaagaagcgcatagttgcttccatctgtgttgtgacggtttttattggtttattgtatgtgtatggtgg |
33655383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 180 - 255
Target Start/End: Original strand, 15954469 - 15954544
Alignment:
| Q |
180 |
ataaatgtcgaggggaagatctgatgggtcacaaaagaagcgcatagttgcttccatctgtgttgtgacggttttt |
255 |
Q |
| |
|
||||||||||||||| ||||||||||| || ||||||||||| ||||||||||| | |||| |||| || ||||| |
|
|
| T |
15954469 |
ataaatgtcgaggggcagatctgatggatcgcaaaagaagcgtttagttgcttccgtttgtggtgtggcgcttttt |
15954544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University