View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9330_high_26 (Length: 243)
Name: NF9330_high_26
Description: NF9330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9330_high_26 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 110; Significance: 1e-55; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 11026915 - 11027028
Alignment:
| Q |
1 |
aagtccttgtatttactattaaaaagttcacaagtaaaattttcactcagttaataaaataaacaaagaaacttttactgcaagtggtttaattctacaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
11026915 |
aagtccttgtatttactattaaaaagttcacaagtaaaattttcactcagttaataaaataaacagagaaacttttactgcaagtggtttaattctacaa |
11027014 |
T |
|
| Q |
101 |
gagcttaatttata |
114 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
11027015 |
gagcttaatttata |
11027028 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 106 - 227
Target Start/End: Original strand, 11033602 - 11033715
Alignment:
| Q |
106 |
taatttatactcttcattgccacttttattgaagtaaaacacacggaaggtggtaatgttattttcaagtactctattagagaaaagaatattatcctta |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
11033602 |
taatttatactcttcattgccacttttattgaagtaaaacacacggaaggtggtgatgttactttcaag--------tagagaaaagaatattatcctta |
11033693 |
T |
|
| Q |
206 |
ttgcacatctgcttttgtttgt |
227 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
11033694 |
ttgcacatctgcttttgtttgt |
11033715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University