View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9330_low_25 (Length: 377)
Name: NF9330_low_25
Description: NF9330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9330_low_25 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 141; Significance: 8e-74; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 141; E-Value: 8e-74
Query Start/End: Original strand, 180 - 364
Target Start/End: Complemental strand, 3002438 - 3002254
Alignment:
| Q |
180 |
ttggtactttcagtaggtctggttctgctctgcggagtattggttttatggttgtcgttggggcgtgctcagccttagtcagctgatgagaggtgttgtg |
279 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| ||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3002438 |
ttggtactttcagtaggtctggttctactctgcggggtattggttttctggttgtcgtcggggcgtgctcagccttagtcagctgatgagaggtgttgtg |
3002339 |
T |
|
| Q |
280 |
ttgctgcaatttttatttggtcgcttttgcaaggtgtgtgttctgctaagaccatttagttttgctgtgttttttctgtctcatt |
364 |
Q |
| |
|
||||||||||||||||||||| | |||| ||||||||||||| |||| ||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
3002338 |
ttgctgcaatttttatttggttgttttttcaaggtgtgtgttttgctgagaccatttagttttgctgcgttttttcggtctcatt |
3002254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 180 - 364
Target Start/End: Complemental strand, 3010824 - 3010636
Alignment:
| Q |
180 |
ttggtactttcagtaggtctggttctgctctgcggagtattggttttatggttgtcgttggggcgtgctcagccttagtcagctgatgagaggtgttgtg |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||| | ||||| |||||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
3010824 |
ttggtactttcagtaggtctggttctgctctgcggggtattggttatctggttatcgttggggcgtgctcagtcttagtccgctgatgagaggtgttgtg |
3010725 |
T |
|
| Q |
280 |
ttgctgcaatttttatttggtcgcttttgcaaggt----gtgtgttctgctaagaccatttagttttgctgtgttttttctgtctcatt |
364 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||| |||||||||||| ||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
3010724 |
ttgctgcaatttttatttggttgtttttgcaaggtgtacgtgtgttctgctgagaccgtttagttttgctgcgttttttctgtctcatt |
3010636 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University