View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9330_low_27 (Length: 366)
Name: NF9330_low_27
Description: NF9330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9330_low_27 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 146; Significance: 8e-77; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 146; E-Value: 8e-77
Query Start/End: Original strand, 15 - 164
Target Start/End: Complemental strand, 45483345 - 45483196
Alignment:
| Q |
15 |
ttattctatgcttattactgtgactgatatttcctttagagtgcccttcttttatcactctcattctttatcttaactaacttattttcctcgtttacca |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45483345 |
ttattctatgcttattactgtgactgatatttcctttagagtgcccttcttttatcactctcattctttatcttaactaacttattttcctcgtttacca |
45483246 |
T |
|
| Q |
115 |
aatttgtactgagatattaggtctgttctcatttaggatccatagttggg |
164 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45483245 |
aatttgtaccgagatattaggtctgttctcatttaggatccatagttggg |
45483196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 106; E-Value: 6e-53
Query Start/End: Original strand, 217 - 348
Target Start/End: Complemental strand, 45483143 - 45483013
Alignment:
| Q |
217 |
gtaaaccagaaacaatgtgtttcttgtttgtacagnnnnnnncacttttcttttgaaatagtttcaattatttgttttttctcataggcgactcaaagta |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45483143 |
gtaaaccagaaacaatgtgtttcttgtttgtacagaaaaaa-cacttttcttttgaaatagtttcaattatttgttttttctcataggcgactcaaagta |
45483045 |
T |
|
| Q |
317 |
agcagaatttgatctatgtagccgaccccact |
348 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
45483044 |
agcagaatttgatctatgtagccgaccccact |
45483013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University