View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9330_low_33 (Length: 304)
Name: NF9330_low_33
Description: NF9330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9330_low_33 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 19 - 299
Target Start/End: Original strand, 40472756 - 40473037
Alignment:
| Q |
19 |
agtagtggtccgttcaaggttcactcggttggaacttccagt-cggtttttaaaacactgcattatggtatgttgcactgaatgttcacctgagaagggg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40472756 |
agtagtggtccgttcaaggttcactcggttggaacttccagttcagtttttaaaacactgcattatggtatgttgcactgaatgttcacctgagaagggg |
40472855 |
T |
 |
| Q |
118 |
ggatattcattgctggcttgaacctcactgtctttggcctaatggcggatattgtagtttgagaagatgcaattggaggagtggaatcgattgcacctgc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40472856 |
ggatattcattgctggcttgaacctcactgtctttggcctaatggcggatattgtagtttgagaagatgcaattggaggagtggaatcgattgcacctgc |
40472955 |
T |
 |
| Q |
218 |
tagaagttctgagaaagatttgtaagaagaacaagtaggccttgaagcaactggtttggcaacaactactctctctgcttct |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
40472956 |
tagaagttctgagaaagatttgtaagaagaacaagtaggccttgaagcaactggtttggcaacaactactctttctgcttct |
40473037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University