View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9330_low_35 (Length: 293)
Name: NF9330_low_35
Description: NF9330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9330_low_35 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 24 - 276
Target Start/End: Complemental strand, 36205637 - 36205385
Alignment:
| Q |
24 |
aaggcagcaggcggggcttcctcgatgtcttcagctctgcaaacaccaagtctcatcgaacctctgtacatgattatctttgccttgcgcagtacaattg |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
36205637 |
aaggcagcaggcggggcttcctcgatgtcttcagctctgcaaacaccaagtctcatcgaacctctgtacatgattatctttgccttgtgcagtacaattg |
36205538 |
T |
|
| Q |
124 |
ttgatcggtctttgactctgttgatcttatcagcaccgactgatcgcaatatgatgatgccagtttcatcacctacaagagactctgtcaccggcatatg |
223 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
36205537 |
ttgatccttctttgactctgttgatcttatcagcaccgactgctcgcaatatgatgatgccagtttcgtcgcctacaagagactctgtcaccggcatatg |
36205438 |
T |
|
| Q |
224 |
acccttacggcctacttttttcacattgactactttaagagttaggttgatgt |
276 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
36205437 |
acccttactagatacttttttcacattgactactttgagagttatgttgatgt |
36205385 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 35 - 194
Target Start/End: Complemental strand, 36195220 - 36195061
Alignment:
| Q |
35 |
cggggcttcctcgatgtcttcagctctgcaaacaccaagtctcatcgaacctctgtacatgattatctttgccttgcgcagtacaattgttgatcggtct |
134 |
Q |
| |
|
||||||||| | |||||||| ||||||| ||||| ||||||||||||||| | ||||| | |||| |||||||||||| |||||| ||||||| ||| |
|
|
| T |
36195220 |
cggggcttctactatgtcttccgctctgcgaacactgagtctcatcgaacctttatacataagtatccttgccttgcgcactacaatggttgatccctct |
36195121 |
T |
|
| Q |
135 |
ttgactctgttgatcttatcagcaccgactgatcgcaatatgatgatgccagtttcatca |
194 |
Q |
| |
|
|| |||| ||||| |||||| | |||| | || |||||||||||||||||||||||| |
|
|
| T |
36195120 |
ttcactcgattgattttatcaccgccgatcgctctgaatatgatgatgccagtttcatca |
36195061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University