View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9330_low_36 (Length: 293)
Name: NF9330_low_36
Description: NF9330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9330_low_36 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 1 - 275
Target Start/End: Original strand, 29473140 - 29473425
Alignment:
| Q |
1 |
aattgagctgaatttaggcactatgacactaactttcacatagtttca----------tattggaaatgattacatcaatgactcaaccaaaattcaatt |
90 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
29473140 |
aattgagctgaatttaggcactatggcactaactttcacatagtttcatattcattcatattggaaatgattacatcaatgacccaaccaaaattaaatt |
29473239 |
T |
 |
| Q |
91 |
cccataatggtaggctcagcaacaatggcggagaattgtgatgatcctaacaaatccacacgtccttattctcnnnnnnnncattccacacacaccattt |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
29473240 |
cccataatggtaggctcagcaacaatggcggagaattgtgatgatcctaacaaatccacacgtccttattctc-tttttttcattccacacacaccattt |
29473338 |
T |
 |
| Q |
191 |
agtcaaacac--atgatatagtaactgttcatnnnnnnnccacacattatggttctgattaatttcattacaacaatatggaccaaa |
275 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
29473339 |
agtcaaacacatatgatatagtaactgttcataaaaaaaccacacattatggttctgattaatttcattacaacaacatggaccaaa |
29473425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University