View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9330_low_42 (Length: 280)
Name: NF9330_low_42
Description: NF9330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9330_low_42 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 112; Significance: 1e-56; HSPs: 8)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 153 - 264
Target Start/End: Original strand, 13411550 - 13411661
Alignment:
| Q |
153 |
gttttgatgtattgcagggagaaaaatggtagctggtagtggaatgggaggaatgaaggaaactcaagagatgattgattttgctgctaaacacaatgta |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13411550 |
gttttgatgtattgcagggagaaaaatggtagctggtagtggaatgggaggaatgaaggaaactcaagagatgattgattttgctgctaaacacaatgta |
13411649 |
T |
 |
| Q |
253 |
caacctgatatt |
264 |
Q |
| |
|
|||||||||||| |
|
|
| T |
13411650 |
caacctgatatt |
13411661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 11 - 112
Target Start/End: Original strand, 13411407 - 13411509
Alignment:
| Q |
11 |
cagagaagcctcttgagttaccagcatggcctttactagtgggtaagca-tatgaaatttatattattgtagaacatgtgtatttcgtatgcttagacat |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
13411407 |
cagagaagcctcttgagttaccagcatggcctttactagtgggtaagcattatgaaatttatattattgtagaacatgtgtacttcgtatgcttagacat |
13411506 |
T |
 |
| Q |
110 |
tag |
112 |
Q |
| |
|
||| |
|
|
| T |
13411507 |
tag |
13411509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 166 - 260
Target Start/End: Original strand, 13386052 - 13386146
Alignment:
| Q |
166 |
gcagggagaaaaatggtagctggtagtggaatgggaggaatgaaggaaactcaagagatgattgattttgctgctaaacacaatgtacaacctga |
260 |
Q |
| |
|
||||||||||| |||||||||| |||||||| ||| | || ||||| |||||||||||| |||| ||||||||||||||||||||| ||||||| |
|
|
| T |
13386052 |
gcagggagaaagctggtagctggaagtggaattggaagcattaaggagactcaagagatgcttgaatttgctgctaaacacaatgtaaaacctga |
13386146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 166 - 249
Target Start/End: Original strand, 13394300 - 13394383
Alignment:
| Q |
166 |
gcagggagaaaaatggtagctggtagtggaatgggaggaatgaaggaaactcaagagatgattgattttgctgctaaacacaat |
249 |
Q |
| |
|
||||||||||| | | || |||| ||||| || ||||| ||||| || || ||||| ||||||||||||||||||||||||||| |
|
|
| T |
13394300 |
gcagggagaaagacgatatctggcagtggcattggaggcatgaaagagacacaagaaatgattgattttgctgctaaacacaat |
13394383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 214 - 252
Target Start/End: Complemental strand, 13446440 - 13446402
Alignment:
| Q |
214 |
actcaagagatgattgattttgctgctaaacacaatgta |
252 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
13446440 |
actcaagaaatgattgattttgctgctaaacacaatgta |
13446402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 166 - 260
Target Start/End: Original strand, 13389840 - 13389934
Alignment:
| Q |
166 |
gcagggagaaaaatggtagctggtagtggaatgggaggaatgaaggaaactcaagagatgattgattttgctgctaaacacaatgtacaacctga |
260 |
Q |
| |
|
||||||||||| ||||||| || ||| || ||||| || ||||| |||||||||||| |||| |||||||||||||||| ||| ||||||| |
|
|
| T |
13389840 |
gcagggagaaagctggtagccggaagtaatattggaggcatcaaggagactcaagagatgcttgactttgctgctaaacacagcgtaaaacctga |
13389934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 199 - 264
Target Start/End: Complemental strand, 13425749 - 13425684
Alignment:
| Q |
199 |
ggaggaatgaaggaaactcaagagatgattgattttgctgctaaacacaatgtacaacctgatatt |
264 |
Q |
| |
|
||||| || ||||| |||||||| |||||||||||||| || ||||||||||| |||||||||| |
|
|
| T |
13425749 |
ggagggataaaggagactcaagaaatgattgattttgcggccgaacacaatgtaacacctgatatt |
13425684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 199 - 264
Target Start/End: Complemental strand, 13453272 - 13453207
Alignment:
| Q |
199 |
ggaggaatgaaggaaactcaagagatgattgattttgctgctaaacacaatgtacaacctgatatt |
264 |
Q |
| |
|
||||| || ||||| |||||||| |||||||||||||| || ||||||||||| | ||||||||| |
|
|
| T |
13453272 |
ggagggatcaaggagactcaagaaatgattgattttgcggcggaacacaatgtaaagcctgatatt |
13453207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 166 - 258
Target Start/End: Complemental strand, 47600667 - 47600575
Alignment:
| Q |
166 |
gcagggagaaaaatggtagctggtagtggaatgggaggaatgaaggaaactcaagagatgattgattttgctgctaaacacaatgtacaacct |
258 |
Q |
| |
|
||||||||||| || |||||||| ||| || ||||| |||||||| |||||||| ||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
47600667 |
gcagggagaaagatagtagctggaagtaatattggagggatgaaggagactcaagatatgcttgattttgctgctaaacacaatgtaaaacct |
47600575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University