View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9330_low_45 (Length: 260)
Name: NF9330_low_45
Description: NF9330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9330_low_45 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 8 - 245
Target Start/End: Original strand, 39367309 - 39367546
Alignment:
| Q |
8 |
ttggtggtgctgttgttggttccaaagtctcacctgctgatgcagcctatggtcaatctggtattttactttctctctttttcataatcatattatatcg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
39367309 |
ttggtggtgctgttgttggttccaaagtctcacctgctgatgcagcctatggtcaatctggtattttactttctctctttttcataatcaaattatatcg |
39367408 |
T |
 |
| Q |
108 |
tttaatttatttatgagtaatcataacgtatgtattatgaagtaaaaatatacttaagttgtttgttagttgaaattatagagctgtatcaacctaatcc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39367409 |
tttaatttatttatgagtaatcataacgtatgtattatgaagtaaaaatatacttaagttgtttgttagttgaaattatagagctgtatcaacctaatcc |
39367508 |
T |
 |
| Q |
208 |
tcagcttatcaatattccaatatgatccatgaaatttc |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39367509 |
tcagcttatcaatattccaatatgatccatgaaatttc |
39367546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University