View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9330_low_53 (Length: 246)
Name: NF9330_low_53
Description: NF9330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9330_low_53 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 11033849 - 11034060
Alignment:
| Q |
1 |
ccggcttgtcacttataaggttcaattaacatcactgttaccatttatttctttctctctagcttcacatgatcatagcttcacatgatcattgatcatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
11033849 |
ccggcttgtcacttataaggttcaattat-atcactgttaccatttatttctttctctctagc----------------ttcacatgatcattgatcatg |
11033931 |
T |
 |
| Q |
101 |
gcagatgatgatggtgaccatcctttttataagaactttattgtcctacttattgtcgtgggttcagctgcatttgtggttgcttcaatgtaccgtctct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
11033932 |
gcagatgatgatggtgaccatcctttttataagaactctattgtactacttattgtcgtgggttcagctgcatttgtggttgcttcaatgtaccgtgtct |
11034031 |
T |
 |
| Q |
201 |
tagtcatttggttttgtcaccctcaaagt |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
11034032 |
tagtcatttggttttgtcaccctcaaagt |
11034060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University