View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9330_low_57 (Length: 239)

Name: NF9330_low_57
Description: NF9330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9330_low_57
NF9330_low_57
[»] chr5 (2 HSPs)
chr5 (11-96)||(34680251-34680336)
chr5 (169-223)||(34680126-34680180)


Alignment Details
Target: chr5 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 11 - 96
Target Start/End: Complemental strand, 34680336 - 34680251
Alignment:
11 ataatactttcctcgttttgcatagtattgaaactagacagaaagaatcattttgggtggaattcacttgaggctctcttcttctc 96  Q
    ||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34680336 ataatgcttttctcgttttgcatagtattgaaactagacagaaagaatcattttgggtggaattcacttgaggctctcttcttctc 34680251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 169 - 223
Target Start/End: Complemental strand, 34680180 - 34680126
Alignment:
169 taccaatagatcctattgtttttgtggcaaagatgtgtggataggttggagaaag 223  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34680180 taccaatagatcctattgtttttgtggcaaagatgtgtggataggttggagaaag 34680126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University