View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9330_low_57 (Length: 239)
Name: NF9330_low_57
Description: NF9330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9330_low_57 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 11 - 96
Target Start/End: Complemental strand, 34680336 - 34680251
Alignment:
| Q |
11 |
ataatactttcctcgttttgcatagtattgaaactagacagaaagaatcattttgggtggaattcacttgaggctctcttcttctc |
96 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34680336 |
ataatgcttttctcgttttgcatagtattgaaactagacagaaagaatcattttgggtggaattcacttgaggctctcttcttctc |
34680251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 169 - 223
Target Start/End: Complemental strand, 34680180 - 34680126
Alignment:
| Q |
169 |
taccaatagatcctattgtttttgtggcaaagatgtgtggataggttggagaaag |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34680180 |
taccaatagatcctattgtttttgtggcaaagatgtgtggataggttggagaaag |
34680126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University