View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9331_high_24 (Length: 247)
Name: NF9331_high_24
Description: NF9331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9331_high_24 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 23 - 237
Target Start/End: Complemental strand, 54733376 - 54733162
Alignment:
| Q |
23 |
gcgacgaaattcgtcgctgctcattccatcttcgggatataaactccattttttctctttatcaacttcaatgtttttcctcttactcttatcattatca |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54733376 |
gcgacgaaattcgtcgctgctcattccatcttcaggatataaactccattttttctctttatcaacttcaatgtttttcctcttactcttatcattatca |
54733277 |
T |
 |
| Q |
123 |
ctctcacacctttgcaacactctttgatccttcgcatcatcactattcacacccctcaccaactcaatttccgattgacacctcctatatcccttcactt |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54733276 |
ctctcacacctttgcaacactctttgatccttcgcatcatcactattcacacccctcaccaactcaatttccgattgacacctcctatatcccttcactt |
54733177 |
T |
 |
| Q |
223 |
ccaaacccatctctg |
237 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
54733176 |
ccaaacccatctctg |
54733162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University