View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9331_high_27 (Length: 240)
Name: NF9331_high_27
Description: NF9331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9331_high_27 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 18 - 240
Target Start/End: Complemental strand, 18575617 - 18575395
Alignment:
| Q |
18 |
attttcgtactagggacgaattaatcctctcgtttaataagttagagactaatttgtcaccagtatgtaaatgtcatagattagtttgagtttatttctt |
117 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||| ||||||||||||||||||| || |
|
|
| T |
18575617 |
attttcgtactagggacaaattaatcctctcgtttaataagttagtgactaatttgtcaccggtatgtaaatgtcatggattagtttgagtttatttttt |
18575518 |
T |
 |
| Q |
118 |
gtcggacactgaatttgagccgtgaaaaagttatgaaggactgaattgggtatttattcttgattctattataggggttaggatcctctccattatttcg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18575517 |
gtcggacactgaatttgagccgtgaaaaagttatgaaggactgaattgggtatttattcttgattctattataggggttaggatcctctccattatttcg |
18575418 |
T |
 |
| Q |
218 |
aacaacatgataaattacgattc |
240 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
18575417 |
aacaacatgataaattacgattc |
18575395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University