View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9331_high_32 (Length: 201)

Name: NF9331_high_32
Description: NF9331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9331_high_32
NF9331_high_32
[»] chr1 (1 HSPs)
chr1 (13-183)||(37620639-37620806)


Alignment Details
Target: chr1 (Bit Score: 127; Significance: 9e-66; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 13 - 183
Target Start/End: Original strand, 37620639 - 37620806
Alignment:
13 attatacttgtagctgcatgagccnnnnnnnngtggaaaaatcatagtgtgtgtttggttgaattgtggccaatagtcaccgtgaatttagagctctttt 112  Q
    ||||||||||||||||||||||||        ||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||    
37620639 attatacttgtagctgcatgagccaaaaaaa-gtggaaaaatcatagtgt--gtttggttgaattgtggccaatagtcaccgtgaatttagagctctttt 37620735  T
113 aatgtagtcttcagttcttttaaagctaatatagtgtacggtttaatgtgatttatcttttttacgtctaa 183  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
37620736 aatgtagtcttcagttcttttaaagctaatatagtgtacggtttaatgtgatttatcttttttatgtctaa 37620806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University