View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9331_high_7 (Length: 356)
Name: NF9331_high_7
Description: NF9331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9331_high_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 4 - 210
Target Start/End: Original strand, 1704214 - 1704420
Alignment:
| Q |
4 |
agaaaatatgtaccaataacttctgcagttaccttttgtatcaaggttattacacgccttgatgaacaacaatgtttcaagagggaattgtttccttggt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1704214 |
agaaaatatgtaccaataacttctgcagttaccttttgtatcaaggttattacacgccttgatgaacaacaatgtttcaagagggaattgtttccttggt |
1704313 |
T |
 |
| Q |
104 |
gtttgattgccattgatgctatatattttctcaactcacatgtagttggagagataggtgcattgtgtgtgtctatgtgtatatatagatataagaagaa |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
1704314 |
gtttgattgccattgatgctatatattttctcaactcacatgtagttggagagataggtgcattgtgtgtgtctatgtgtatatatagacataagaagaa |
1704413 |
T |
 |
| Q |
204 |
gaagaag |
210 |
Q |
| |
|
||||||| |
|
|
| T |
1704414 |
gaagaag |
1704420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 268 - 340
Target Start/End: Original strand, 1704481 - 1704555
Alignment:
| Q |
268 |
taggtcatttggag--ggagtgatataagagataaggtgatgtctatgttcgactactctactaacattcattat |
340 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1704481 |
taggtcatttggagagggagtgatataagagataaggtgatgtctatgttcgactactctactaacattcattat |
1704555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University