View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9331_high_9 (Length: 351)
Name: NF9331_high_9
Description: NF9331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9331_high_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 20 - 340
Target Start/End: Complemental strand, 8931207 - 8930887
Alignment:
| Q |
20 |
agttttacaagcaatatatattactagttactacgattcagattacaataaaaccactaaaccgtactgcgagggctatcgcctccctcaccctagtcgc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8931207 |
agttttacaagcaatatatattactagttactacgattcagattacaataaaaccactgaaccgtactgcgagggctatcgcctccctcaccctagtcgc |
8931108 |
T |
|
| Q |
120 |
cccctagctataacaaacggttgggcctaagacacgtccctgcgaggatgggtttagaatcttgccatggggtgtacagaccctcctatagaaactaaca |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8931107 |
cccctagctataacaaacggttgggcctaagacacgtccctgcgaggaagggtttagaatcttgccatggggtgtacagaccctcctatagaaactaaca |
8931008 |
T |
|
| Q |
220 |
gcttgccctttggtgggttgcaatataattggttcaactattcacttttaaactagtaaactttaaattttatctgttagtttattcgtaataaactcat |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
8931007 |
gcttgccctttggtgggttgcaatataattggttcaactatttacttttaaactagtaaactttaaattttatctgttagtttaatcgtaataaactcat |
8930908 |
T |
|
| Q |
320 |
tcacatatttgccacaggttc |
340 |
Q |
| |
|
||||||||||| ||||||||| |
|
|
| T |
8930907 |
tcacatatttgtcacaggttc |
8930887 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University