View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9331_low_17 (Length: 381)
Name: NF9331_low_17
Description: NF9331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9331_low_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 47; Significance: 1e-17; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 317 - 371
Target Start/End: Original strand, 41404417 - 41404471
Alignment:
| Q |
317 |
gttcgtgaagatttaaggttgtgattgtgatatatgtttacgtgaactgtctctg |
371 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
41404417 |
gttcgtgaagatttaaggttgtgattgtggtatatgtttacgtgaaccgtctctg |
41404471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University