View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9331_low_17 (Length: 381)

Name: NF9331_low_17
Description: NF9331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9331_low_17
NF9331_low_17
[»] chr7 (1 HSPs)
chr7 (317-371)||(41404417-41404471)


Alignment Details
Target: chr7 (Bit Score: 47; Significance: 1e-17; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 317 - 371
Target Start/End: Original strand, 41404417 - 41404471
Alignment:
317 gttcgtgaagatttaaggttgtgattgtgatatatgtttacgtgaactgtctctg 371  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||| |||||||    
41404417 gttcgtgaagatttaaggttgtgattgtggtatatgtttacgtgaaccgtctctg 41404471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University