View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9331_low_34 (Length: 304)
Name: NF9331_low_34
Description: NF9331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9331_low_34 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 285
Target Start/End: Complemental strand, 20612838 - 20612556
Alignment:
| Q |
1 |
agaagtcgcaaccccgtgcgcaacgtgacgaagcatgtacatccaaagtcgttgaggtggttagcgcacaacaaagcacaactcaaggtgtttctactat |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||| ||||||||||| |
|
|
| T |
20612838 |
agaagtggcaaccccgtgcgcaacgtgacgaagcatgtacatccaaagtcgttgaggtggttagtgcacaacaaagcacagctcaagttgtttctacta- |
20612740 |
T |
 |
| Q |
101 |
acagttaattcacaattggtagtggtttccagaaataaaggtaacactacggaggggcaagtgacttacgatacttcaaccttgttaatgtttggtaatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
20612739 |
-cagttaattcacaattggtagtggttgccagaaataaaggtaacactatggaggggcaagtgacttacgattcttcaaccttggtaatgtttggtaatt |
20612641 |
T |
 |
| Q |
201 |
catccaattgagttgcggttccatcatctctttctgccaattcgttaagttttgcattaaataatgtgacagatgaggttcccag |
285 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20612640 |
catccaactgagttgcggttccatcatctctttctgccaattcgttcagttttgcattaaataatgtgacagatgaggttcccag |
20612556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University