View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9331_low_41 (Length: 288)
Name: NF9331_low_41
Description: NF9331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9331_low_41 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 276
Target Start/End: Original strand, 17283855 - 17284130
Alignment:
| Q |
1 |
catcctgcaaacctcaaattttctccacatgtaaaattaaggaatcaatttcggcacattcgtaaaatagaaggataccaaccttttaacactattaccc |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17283855 |
catcccgcaaacctcaaattttctccacatgtaaaattaaggaatcaatttcggcacattcgtaaaatagaaggataccaaccttttaacactattaccc |
17283954 |
T |
 |
| Q |
101 |
ggttgaaccacacaactaccaataccaacgtcaacattccactttcttgaagaagccatggaagaagcacgcgctgcctggatgacattctaacgtcgcg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||| || |||||||||||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
17283955 |
ggttgaaccacacaactaccaataccaacgtcaacatcccactttcttggagcagccatggaagaagcacgggctgcctggatgacattctaaggtcgcg |
17284054 |
T |
 |
| Q |
201 |
cagaaacaccatcatccttgtcgctgtaatcatgtcgaaccttctcccttgcaaccgaaaaccataccttcaacct |
276 |
Q |
| |
|
||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17284055 |
cagaaacaccatcatccttgtcgttttaatcatgtcgaaccttctcccttgcaaccgaaaaccataccttcaacct |
17284130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University