View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9331_low_77 (Length: 201)
Name: NF9331_low_77
Description: NF9331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9331_low_77 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 127; Significance: 9e-66; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 13 - 183
Target Start/End: Original strand, 37620639 - 37620806
Alignment:
| Q |
13 |
attatacttgtagctgcatgagccnnnnnnnngtggaaaaatcatagtgtgtgtttggttgaattgtggccaatagtcaccgtgaatttagagctctttt |
112 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37620639 |
attatacttgtagctgcatgagccaaaaaaa-gtggaaaaatcatagtgt--gtttggttgaattgtggccaatagtcaccgtgaatttagagctctttt |
37620735 |
T |
|
| Q |
113 |
aatgtagtcttcagttcttttaaagctaatatagtgtacggtttaatgtgatttatcttttttacgtctaa |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
37620736 |
aatgtagtcttcagttcttttaaagctaatatagtgtacggtttaatgtgatttatcttttttatgtctaa |
37620806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University