View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9332_low_10 (Length: 350)
Name: NF9332_low_10
Description: NF9332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9332_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 45 - 340
Target Start/End: Original strand, 4189725 - 4190023
Alignment:
| Q |
45 |
ttgttgtcatttttgtattgtagtgtgttagtcgaacggacaa----acgagccgaatctaacgagttgaatagagttattcacctatctagacaagtta |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4189725 |
ttgttgtcatttttgtattgtagtgtgttagtcgaacgaacaattaaacgagccgaatctaatgagttgaatagagttattcacctatctagacaagtta |
4189824 |
T |
 |
| Q |
141 |
aactagaactaaaagaaatattcacatcaaattggttgagtttcaaaccgaatcaattcttattgagttggggtcaaattttacggagtttgactaaatc |
240 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||| | |
|
|
| T |
4189825 |
aactagaactaaaagaaatatacacatcaaattggttgagtttcaaatcgaatcaattcttattgagttggg-tcaaattttacggagtttgactaaacc |
4189923 |
T |
 |
| Q |
241 |
gacttatttcatttccagtcatatttacaatattgtagaagatccaaacatgttagacaaatttggattgtctgtagcactgcacacactgtagcaacac |
340 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4189924 |
gacttatttcatttcgagtcatatttacaatattgtagaagatccaaacatgttagacaaatttggattgtctgtagcactgcacacactgtagcaacac |
4190023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University