View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9332_low_15 (Length: 330)
Name: NF9332_low_15
Description: NF9332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9332_low_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 235; Significance: 1e-130; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 18 - 315
Target Start/End: Complemental strand, 7887621 - 7887324
Alignment:
| Q |
18 |
gaaggtgcatctacgactatactataagtcacttggttaactctttcatttccccctttttaggttcatgtttgtcagattttaaaacttttccttttac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
7887621 |
gaaggtgcatctacgactatactataagtcacttggttaactctttcatttccccctttttaggttcatgtttgtcaggttttaaaactttgccttttac |
7887522 |
T |
|
| Q |
118 |
ctgtttcattaaatgcctcattggctttcacttaaaccactcaagnnnnnnnnnnnnnatgaaatggtaactcataatcattaattgaaaactatcaagt |
217 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
7887521 |
ctgtttcattaaatgcctcgttggctttcacttaaaccactcaagttttttcctttttatgaaatggtaactcataatcattagttgaaaactatcaagt |
7887422 |
T |
|
| Q |
218 |
ataagcacattacacgcactcatacatagacattggtgaaatttttatagaagtgattgcttgtaataatgagtgttgagatggcatgtgttggactg |
315 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7887421 |
ataagcacattacacccactcatacgtagacattggtgaaatttttatagaagtgattgcttgtaataatgagtgttgagatggcatgtgttggactg |
7887324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 87 - 162
Target Start/End: Complemental strand, 7918479 - 7918405
Alignment:
| Q |
87 |
gtttgtcagattttaaaacttttccttttacctgtttcattaaatgcctcattggctttcacttaaaccactcaag |
162 |
Q |
| |
|
||||||||| |||| ||||||| |||||||||||||| ||||||||| || |||| |||||| |||||||||||| |
|
|
| T |
7918479 |
gtttgtcaggttttgaaactttgccttttacctgtttgattaaatgcttc-ttgggtttcaccgaaaccactcaag |
7918405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University