View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9332_low_16 (Length: 324)
Name: NF9332_low_16
Description: NF9332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9332_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 18 - 312
Target Start/End: Complemental strand, 53331697 - 53331403
Alignment:
| Q |
18 |
aaaaccactagttcatgaaatgtaaaatggccaaccaagcatggttcacttcccccttggccctccacgtgcctcaacatctgagtttgaagacttgagt |
117 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
53331697 |
aaaaccactagtttatgaaatgtaaaatggccaaccaagcatggttcacttcccccttggccctccatgtgcctcaacatctgagtttgaagacttgagt |
53331598 |
T |
 |
| Q |
118 |
gcaagaatggctttataaaatggatcaatttgcctcccaatattttagaataacattatgataaactggtaatagagcagtgcaacaaggcgacatttaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53331597 |
gcaagaatggctttataaaatggatcaatttgcctcccaatattttagaataacattatgataaactggtaatagagcagtgcaacaaggcgacatttaa |
53331498 |
T |
 |
| Q |
218 |
aggctatatatttaagtagagataacaaacaataattgatctcccaagttaacttaatcaaaatatatggatgctaacaagttaacttccccctt |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53331497 |
aggctatatatttaagtagagataacaaacaataattgatctcccaagttaacttaatcaaaatatatggatgctaacaagttaacttccccctt |
53331403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University