View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9332_low_20 (Length: 310)
Name: NF9332_low_20
Description: NF9332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9332_low_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-109
Query Start/End: Original strand, 95 - 295
Target Start/End: Complemental strand, 44448047 - 44447847
Alignment:
| Q |
95 |
ctactaaactattaaaactgataatggtaatggtaatgagtttcttcaagaaaaaataattaatgttgatagagaacaccaacgccttttgagtatgggc |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44448047 |
ctactaaactattaaaactgataatggtaatggtaatgagtttcttcaagaaaaaataattaatgttgatagagaacaccaacgccttttgagtatgggc |
44447948 |
T |
 |
| Q |
195 |
tagagtcttactttctctcaacttccgatttatttttgaagtattaatgctatgaatcataagttcacgtgttagtgagtagcccttaatctgaaaataa |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44447947 |
tagagtcttactttctctcaacttccgatttatttttgaagtattaatgctatgaatcataagttcacgtgttagtgagtagcccttaatctgaaaataa |
44447848 |
T |
 |
| Q |
295 |
t |
295 |
Q |
| |
|
| |
|
|
| T |
44447847 |
t |
44447847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University