View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9332_low_24 (Length: 278)
Name: NF9332_low_24
Description: NF9332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9332_low_24 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 1 - 257
Target Start/End: Original strand, 29337396 - 29337652
Alignment:
| Q |
1 |
atgtgagtaaagtgttgggggacagagaagtcaggtgaaaagaaggacgaagagactgtgtatattattgttgaattcatgcacatccgtgaaacgtctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29337396 |
atgtgagtaaagtgttgggggacagagaagtcaggtgaaaagaaggacgaagagactgtgtatattattgttgaattcatgcacatccgtgaaacgtctt |
29337495 |
T |
|
| Q |
101 |
aaagagagcgatgcagtctgcaacttaatctcaacattattgtttgtgtttgacatacgttgtacaacaataacacagcaaccaaactttgtcccattaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29337496 |
aaagagagcgatgcagtctgcaacttaatctcaacattattgtttgtgtttgacatacgttgtacaacaataacacagcaaccaaactttgtcccattaa |
29337595 |
T |
|
| Q |
201 |
ttaggatcggctacaaggaccaaacgacaatataatattccgtcatatatcatatct |
257 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
29337596 |
gtaggatcggctacatggaccaaacgacgatataatattccgtcatatatcatatct |
29337652 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University