View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9332_low_29 (Length: 251)

Name: NF9332_low_29
Description: NF9332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9332_low_29
NF9332_low_29
[»] chr5 (1 HSPs)
chr5 (1-241)||(7193815-7194055)


Alignment Details
Target: chr5 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 7194055 - 7193815
Alignment:
1 tctatttcaccttgaactagtcacgagtgtgaacacctgaaatcggaaagtaactcattatctttgcatattgtagtttaggaattttcaaatgcatatt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7194055 tctatttcaccttgaactagtcacgagtgtgaacacctgaaatcggaaagtaactcattatctttgcatattgtagtttaggaattttcaaatgcatatt 7193956  T
101 aagattgcagagatttaagtgaactacataactacttaatcagataagagcataaggtaattgcacatgcggttaagtatctacaagtatggatcatact 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
7193955 aagattgcagagatttaagtgaactacataactacttaatcagataagagcataaggtaattgcacatgcggttaagtatctacaagtatcgatcatact 7193856  T
201 taccagcgagataagcgtttttgattatgcttaagtctctg 241  Q
    |||||||||||||||||||||||||||||||||||||||||    
7193855 taccagcgagataagcgtttttgattatgcttaagtctctg 7193815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University