View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9332_low_32 (Length: 244)
Name: NF9332_low_32
Description: NF9332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9332_low_32 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 6321424 - 6321653
Alignment:
| Q |
1 |
tgcgacacattcatttgctatttataacttttcatcatacatgcatgtgttagtaatatgagtcaatggattgattccacaaagggttgaaagcaaaaga |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6321424 |
tgcgacacattcgtttgctatttataacttttcatcatacatgcatgtgttagtaatatgagtcaatggattgattccacaaagggttgaaagcaaaaga |
6321523 |
T |
 |
| Q |
101 |
aactgaaaatcgtgaaaacattagttctcaatttaatcttggtggtgattgataatattttgaaacattttaaataaattaccacaactttttattcttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
6321524 |
aactgaaaatcgtgaaaacattagttctctatttaatcttggtggtgattgctaatattttgaaacattttatataaattaccacaactttttattcttt |
6321623 |
T |
 |
| Q |
201 |
gaaaacatgaagaataatgctacttttgca |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
6321624 |
gaaaacatgaagaataatgctacttttgca |
6321653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University