View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9332_low_37 (Length: 239)
Name: NF9332_low_37
Description: NF9332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9332_low_37 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 17 - 222
Target Start/End: Complemental strand, 38986414 - 38986208
Alignment:
| Q |
17 |
agggataaacatgcaaagttaattgagagttgtaatgat-ggaggaannnnnnngagagggcaaaattggaatgatgtgacaaaaaaggatggcaaaata |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38986414 |
agggataaacatgcaaagttaattgagagttgtaatgatcggaggaatttttttgagagggcaaaattggaatgatgtgacaaaaaaggatggcaaaata |
38986315 |
T |
 |
| Q |
116 |
gacaaatagaatgatagggtttgagcattaaggtttgcacactattccccaattacatataatagtagatagatagattcgttaattgttatgataacac |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||| ||||||||||||||||| |||||||||| |
|
|
| T |
38986314 |
gacaaatagaatgatagggtttgagcattaaggtttgcacactattctccaattacatataataatagataaatagattcgttaattgtcatgataacac |
38986215 |
T |
 |
| Q |
216 |
atcattg |
222 |
Q |
| |
|
||||||| |
|
|
| T |
38986214 |
atcattg |
38986208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University