View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9332_low_40 (Length: 229)
Name: NF9332_low_40
Description: NF9332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9332_low_40 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 211
Target Start/End: Complemental strand, 41029434 - 41029224
Alignment:
| Q |
1 |
atcagcaaactgaaaaccaccagtgtttacagttgagaaagatgaaaaagcaaccgctattctggcaccaaaattgacaaggaaatgcatgtgtccttta |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41029434 |
atcagcaaattgaaaaccaccagtgtttacagttgagaaagatgaaaaagcaaccgctattctggcaccaaaattgacaaggaaatgcatgtgtccttta |
41029335 |
T |
|
| Q |
101 |
ggaaacacaatacatctccacctctaatagttttttgaaacacttcttcatttatcaccaagccatctgtaagctcagctaccaccatgatcaaaaaatc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
41029334 |
ggaaacacaatacatctccacctctaatagttttttgaaacacttcttcatttatcaccaacccatctgtcagctcagctaccaccatgatcaaaaaatc |
41029235 |
T |
|
| Q |
201 |
tgtggcaacat |
211 |
Q |
| |
|
|| |||||||| |
|
|
| T |
41029234 |
tgcggcaacat |
41029224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University