View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9333_low_7 (Length: 255)
Name: NF9333_low_7
Description: NF9333
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9333_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 16 - 246
Target Start/End: Original strand, 52432327 - 52432556
Alignment:
| Q |
16 |
gttgttattccaaatgcaccacaagagcatagcaacccaccctgctatgatacaatactcatgcttgcaatttgcaaatataacaattctgcataagtgc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
52432327 |
gttgttattccaaatgcaccacaagagcatagcaacccaccctgctatgatacaatactcatgcttgcaatttgcaaatataaaaattctgcataagtgc |
52432426 |
T |
 |
| Q |
116 |
taaactgagccaatgtgttgcaaaacattggtcaaacatgcggccctccagtcacgggtctgctcagaattggnnnnnnnnntatatgaaactcatcatc |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
52432427 |
taaactgagccaatgtgttgcaaaacattggtcaaacatgcggccctccagtcacgggtctgctcagaattggaaaaaaaaa-atatgaaactcatcatc |
52432525 |
T |
 |
| Q |
216 |
ggattctccttcacacaaatggtagaattat |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
52432526 |
ggattctccttcacacaaatggtagaattat |
52432556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University