View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9334_low_5 (Length: 328)
Name: NF9334_low_5
Description: NF9334
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9334_low_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 1 - 311
Target Start/End: Original strand, 47635256 - 47635566
Alignment:
| Q |
1 |
tgttagatatgaattataccctttttatcgaaaccttgctccttcaccatcaccagcgccttcagcagcaccagcgcttgttcctccttcaaccagcact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47635256 |
tgttagatatgaattataccctttttatcgaaaccttgctccttcaccatcaccagcgccttcagcagcaccagcgcttgttcctccttcaaccagcact |
47635355 |
T |
|
| Q |
101 |
cctactttgggaggtaatataatttacgtttgtgataattttgatgaattctgaattttataataactacttgttagggtcacaattatcgacctatttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
47635356 |
cctactttgggaggtaatataatttacgtttgtgataattttgatgaattctgaattttataataactacttgttagggtcacaattatcgatctatttg |
47635455 |
T |
|
| Q |
201 |
actatttcacgtagatgcagaaaagtgtatgcataaaagagaataacaatgtactaaattgactttatcaattagtattaaatagaggcaacaactgtaa |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47635456 |
actatttcacgtagatgcagaaaagtgtatgcataaaagagaataacaatgtactaaattgactttatcaattagtattaaatagaggcaacaactgtaa |
47635555 |
T |
|
| Q |
301 |
ataaccttaat |
311 |
Q |
| |
|
||||||||||| |
|
|
| T |
47635556 |
ataaccttaat |
47635566 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 9674619 - 9674581
Alignment:
| Q |
1 |
tgttagatatgaattataccctttttatcgaaaccttgc |
39 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9674619 |
tgttagatatgaattataccctttttatcgaaaccttgc |
9674581 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University