View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9334_low_8 (Length: 244)
Name: NF9334_low_8
Description: NF9334
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9334_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 6 - 226
Target Start/End: Original strand, 22914358 - 22914578
Alignment:
| Q |
6 |
gtttggtgttcattttatttcttgaattgaaattgaaaattatatcagcaaaacagttaatcattgattgaagaattgaagtgatgttgtatttcgcttt |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22914358 |
gtttggtgttcattttatttcttgaattgaaattgaaaattatatcagcaaaacagttaatcattgattgaagaattgaagtgatgttgtatttcgcttt |
22914457 |
T |
|
| Q |
106 |
gtttctttctttcaatctatgaagaattgaaactgaaaatatattgttgaacaattatttgatggatgattcttgaagagaagaggatgttaaaatagat |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22914458 |
gtttctttctttcaatctatgaagaattgaaactgaaaatatattgttgaacaattatttgatggatgattcttgaagagaagaggatgttaaaatagat |
22914557 |
T |
|
| Q |
206 |
gagaagatatgacactgaaag |
226 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
22914558 |
gagaagatatgacactgaaag |
22914578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 80 - 126
Target Start/End: Original strand, 44535961 - 44536007
Alignment:
| Q |
80 |
attgaagtgatgttgtatttcgctttgtttctttctttcaatctatg |
126 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||| |||| |||| |
|
|
| T |
44535961 |
attgaagtgatgttgtatttcgttgtgtttctttcttccaatttatg |
44536007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University