View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9336_low_12 (Length: 319)
Name: NF9336_low_12
Description: NF9336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9336_low_12 |
 | |
|
| [»] scaffold0001 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0001 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 18 - 221
Target Start/End: Original strand, 3758 - 3959
Alignment:
| Q |
18 |
gtgctgcagcgtggtgcaaaacttttgtgtgtcagtgacttccttctattacgaagagtaaccattgcagaggcacgcagtctgttacactggttggact |
117 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| ||||||||||| |||| |||||| |||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3758 |
gtgctgcagcgtggtgcaa--cttttgtgtgtcactgacttccttcaattaggaagagcaaccattgaagaggcacgcagtctgttacactggttggact |
3855 |
T |
|
| Q |
118 |
ttgaggcaggtttcggcaagatgggtgtattgaattagtgaacttgcaactttataattttctctatgttttttcatacttattagttgttgtgaaaatg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3856 |
ttgaggcaggtttcggcaagatgggtgtattgaattagtgaacttgcaaatttataattttctctatgttttttcatacttattagttgttgtgaaaatg |
3955 |
T |
|
| Q |
218 |
aaaa |
221 |
Q |
| |
|
|||| |
|
|
| T |
3956 |
aaaa |
3959 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 18 - 145
Target Start/End: Original strand, 36752733 - 36752860
Alignment:
| Q |
18 |
gtgctgcagcgtggtgcaaaacttttgtgtgtcagtgacttccttctattacgaagagtaaccattgcagaggcacgcagtctgttacactggttggact |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||| |||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
36752733 |
gtgctgcagcgtggtgcaaaacttttgtgtgtcagtgacttgcttctattaggaagagcaaccattgaagaggcacgcagtctgttacactggttggact |
36752832 |
T |
|
| Q |
118 |
ttgaggcaggtttcggcaagatgggtgt |
145 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
36752833 |
ttgaggcaggtttcggcaagatgggtgt |
36752860 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 212 - 310
Target Start/End: Complemental strand, 32569933 - 32569834
Alignment:
| Q |
212 |
aaaatgaaaaatagtacttcaatttgcgtgatctgtttccgcttttatctgaatat-aaaactaagacattttctagatttatcagtaacacaggttctg |
310 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| |||||||| ||||||| |||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
32569933 |
aaaatgaaaaatagtacttcaaattgcgtgatctgttttggcttttatgtgaatataaaaactaagacaatttctagatttatcagtaacacagtttctg |
32569834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 84; Significance: 7e-40; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 18 - 145
Target Start/End: Complemental strand, 25283547 - 25283420
Alignment:
| Q |
18 |
gtgctgcagcgtggtgcaaaacttttgtgtgtcagtgacttccttctattacgaagagtaaccattgcagaggcacgcagtctgttacactggttggact |
117 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||| ||| ||||| |||||| ||||||| |||||||||| |||||||||| | |||||| | |
|
|
| T |
25283547 |
gtgctgcagcgtggtgcaaaacttttgcgtgtcagtgacttgcttgtattaggaagagctaccattgaagaggcacgccgtctgttacagtagttggaat |
25283448 |
T |
|
| Q |
118 |
ttgaggcaggtttcggcaagatgggtgt |
145 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
25283447 |
ttgaggcaggtttcggcaagatgggtgt |
25283420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University