View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9336_low_17 (Length: 251)
Name: NF9336_low_17
Description: NF9336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9336_low_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 32165615 - 32165372
Alignment:
| Q |
1 |
ttgagttttgcagttgctttaactggttttcaaatttttgcttgttaaatgtacttgaacattgtattttgtatgcttttgaagttttgtattctaattt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32165615 |
ttgagttttgcagttgctttaactggttttcaaatttttgcttgttaaatgtacttgaatattgtattttgtatgcttttgaagttttgtattctaattt |
32165516 |
T |
|
| Q |
101 |
caaaatatggcaatagattttttaatgttttgcttccattagcagcaaacctgtgatatagttaaagacttgtctattttgatgtttattgtcattttag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32165515 |
caaaatatggcaatagattttttaatgttttgcttccattagcagcaaacctgtgacatagttaaagacttgtctattttgatgtttattgtcattttag |
32165416 |
T |
|
| Q |
201 |
gaagtaatgtgaaactataaattttaagaattttgcctttgctt |
244 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
32165415 |
gaagtaatgtgaaactataaattttaagagttttgcctttgctt |
32165372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University