View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9336_low_19 (Length: 243)
Name: NF9336_low_19
Description: NF9336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9336_low_19 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 208; Significance: 1e-114; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 32165682 - 32165908
Alignment:
| Q |
1 |
tcctttaaaatttataacttacaccattgaacagtcaacaaatcaaccaagatgccaaaaatgtgaaaagaaaaataatttaacatgctatttgttagaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
32165682 |
tcctttaaaatttataacttacaccattgaacagtcaacaaatcaaccaagatgccaaaaatgtgaaaagaaaaataacttaacatgctatttgttagaa |
32165781 |
T |
|
| Q |
101 |
acaaaacgagtatggtgtgaat--caagtaatgcctatccaaatgtacatactgaggtaggttggtcccacttaaggttgcgacgatgatggacggaaga |
198 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32165782 |
acaaaacgagtatggtgtgaattgcaagtaatgcctatccaaatgtacatattgaggtaggttggtcccacttaaggttgcgacgatgatggacggaaga |
32165881 |
T |
|
| Q |
199 |
agcaaaatcaagaagggcttgcttatc |
225 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
32165882 |
agcaaaatcaagaagggcttgcttatc |
32165908 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 123 - 225
Target Start/End: Original strand, 32172085 - 32172188
Alignment:
| Q |
123 |
caagtaatgcctatccaa-atgtacatactgaggtaggttggtcccacttaaggttgcgacgatgatggacggaagaagcaaaatcaagaagggcttgct |
221 |
Q |
| |
|
||||| |||||||||||| ||||||||| |||||||| |||||||||||||||||||||||||| ||| || |||||||||||||||||||||||||| |
|
|
| T |
32172085 |
caagtgatgcctatccaagatgtacatattgaggtagcagggtcccacttaaggttgcgacgatgagggatggcagaagcaaaatcaagaagggcttgct |
32172184 |
T |
|
| Q |
222 |
tatc |
225 |
Q |
| |
|
|||| |
|
|
| T |
32172185 |
tatc |
32172188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University