View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9336_low_20 (Length: 214)
Name: NF9336_low_20
Description: NF9336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9336_low_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 1 - 196
Target Start/End: Complemental strand, 43025887 - 43025697
Alignment:
| Q |
1 |
tgtctcaacaccgttaatttcaaatttaagataaaaacgatggtttagaaaaaggctggtttctagttctagcatataaaaatagaaacataactgaatt |
100 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
43025887 |
tgtctcaacacctttaatttcaaatttaagataaaaacgatggtttagaaaaaggctggtttctagttctatcatataaaaatagaaacataactgaatt |
43025788 |
T |
|
| Q |
101 |
gagggttttgcagattggaagt-aattctgatttgtatatgaaacggttgctgctcctgctaggtcattcttcacgtttctaaagttccatgtacaa |
196 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43025787 |
gagggttttgcagattggaagtaaattctgatttgtatatgaaacggttg------ctgctaggtcattcttcacgtttctaaagttccatgtacaa |
43025697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 45; Significance: 8e-17; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 76 - 151
Target Start/End: Complemental strand, 22258054 - 22257972
Alignment:
| Q |
76 |
ataaaaatagaaacataactgaattgagggttttgcagattgga-------agtaattctgatttgtatatgaaacggttgct |
151 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
22258054 |
ataaaaatagaaacataattgaattaagggttttgcagattggatgtaaattgtaattctgatttgtatatgaaacggttgct |
22257972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 79 - 151
Target Start/End: Complemental strand, 30794115 - 30794036
Alignment:
| Q |
79 |
aaaatagaaacataactgaattgagggttttgcagattggaa-------gtaattctgatttgtatatgaaacggttgct |
151 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
30794115 |
aaaatagaaacataattgaattaagggttttgcagattggaaataaattgtaattctgatttgtatataaaacggttgct |
30794036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University