View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9336_low_21 (Length: 211)

Name: NF9336_low_21
Description: NF9336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9336_low_21
NF9336_low_21
[»] chr3 (1 HSPs)
chr3 (18-200)||(25410921-25411099)


Alignment Details
Target: chr3 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 18 - 200
Target Start/End: Original strand, 25410921 - 25411099
Alignment:
18 caaagctagggcttaattaattaaccattgtccctgtctggggaagggtcataaaatgtggggtaaccctatatgctctttatatttgaaagacattgaa 117  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25410921 caaagctagggcttaattaattaaccattgtccctgtctggcgaagggtcataaaatgtggggtaaccctatatgctctttatatttgaaagacattgaa 25411020  T
118 ccaggcaaacgtatgggtagagcttactaccaataccacnnnnnnncgaactatatatgtgtttcacattggcacctttgctt 200  Q
    |||||||||||||||| ||||||||||||||||||||||       |||||    ||||||||||||||||||||||||||||    
25411021 ccaggcaaacgtatggctagagcttactaccaataccacaaaaaaacgaac----tatgtgtttcacattggcacctttgctt 25411099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University