View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9336_low_9 (Length: 346)
Name: NF9336_low_9
Description: NF9336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9336_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 138; Significance: 4e-72; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 193 - 330
Target Start/End: Complemental strand, 28028724 - 28028587
Alignment:
| Q |
193 |
gttaagtacacttattcaaccttggctgtattagagttatccatctttatttgctcaaattcatttttcttctcttctctaccatgtacttttatttagt |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28028724 |
gttaagtacacttattcaaccttggctgtattagagttatccatctttatttgctcaaattcatttttcttctcttctctaccatgtacttttatttagt |
28028625 |
T |
|
| Q |
293 |
tagagagttgagtttgtttagtcagttacacagaatcc |
330 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28028624 |
tagagagttgagtttgtttagtcagttacacagaatcc |
28028587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 9 - 133
Target Start/End: Complemental strand, 28028908 - 28028784
Alignment:
| Q |
9 |
tggtgttctatttaagaattattgtttacaggctatgactaaaatcagcacttcttcaacacttaaatgacactcaagtgttacacttgaaggtcacaac |
108 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28028908 |
tggtgttctatttaagaattactgtttaccggctatgactaaaatcagcacttcttcaacacttaaatgacactcaagtgttacacttgaaggtcacaac |
28028809 |
T |
|
| Q |
109 |
taatggaaaagtttgatgttattta |
133 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
28028808 |
taatggaaaagtttgatgttattta |
28028784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University