View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9337_low_22 (Length: 358)
Name: NF9337_low_22
Description: NF9337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9337_low_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 16 - 353
Target Start/End: Original strand, 34975913 - 34976251
Alignment:
| Q |
16 |
catatgtgatcttaaaaccttgcttgtcacgtctttttgttgtgtaaattagcatatcatagctgcttatgtttgttccattttcattgtaggtaaaaaa |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34975913 |
catatgtgatcttaaaaccttgcttgtcacgtctttttgttgtgtaaattagcatatcatagctgcttatgtttgttccattttcattgtaggtagaaaa |
34976012 |
T |
 |
| Q |
116 |
gcatattccctcacatggactctgcaatatgtcaatcttttcatgataaatactggtttcatcattttggctggttcagctttgaaggtaaaaatatgaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34976013 |
gcatattccctcacatggactctgcaatatgtcaatcttttcatgataaatactggtttcatcattttggctggttcagctttgaaggtaaaaatatgaa |
34976112 |
T |
 |
| Q |
216 |
ataacataatcaaccataatctcattattcgctttagactttagtcatttatcttttctggttgcaccc-nnnnnnnnnnnnnncacttttgaagtcttg |
314 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
34976113 |
ataacataatcaaccataatctcatcattcgctttagactttagtcatttatcttttctggttgcacccaaaaaaaaaaaaaaacacttttgaagtcttg |
34976212 |
T |
 |
| Q |
315 |
tataaaaaatttgagtagttattccatttctctgcttct |
353 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
34976213 |
tataaaaaatttgagtagttattccatttttctgtttct |
34976251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 67; Significance: 1e-29; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 96 - 206
Target Start/End: Original strand, 31320947 - 31321057
Alignment:
| Q |
96 |
ttttcattgtaggtaaaaaagcatattccctcacatggactctgcaatatgtcaatcttttcatgataaatactggtttcatcattttggctggttcagc |
195 |
Q |
| |
|
|||| |||||||| ||||| |||||||| |||| ||||||||||| ||| ||||||||||||||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
31320947 |
ttttaattgtaggcaaaaaggcatattctatcacttggactctgcagtatatcaatcttttcatgataaatactggttacatcattttagctggttcagc |
31321046 |
T |
 |
| Q |
196 |
tttgaaggtaa |
206 |
Q |
| |
|
|||||||||| |
|
|
| T |
31321047 |
cttgaaggtaa |
31321057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University